Slc39a8^em1Xijl
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc39a8^em1Xijl
• Name: solute carrier family 39 (metal ion transporter), member 8; endonuclease-mediated mutation 1, Xiong-Jian Luo
• MGI ID: MGI:7572529
• Synonyms: SLC39A8-p.393T
• Gene: Slc39a8 Location: Chr3:135531040-135594333 bp, + strand Genetic Position: Chr3, 63.04 cM
• Alliance: Slc39a8^em1Xijl page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Alanine codon 393 (GCT) in exon 7 was changed to threonine (ACT) (p.A393T) using an sgRNA (targeting CCCAATATTATATTTGCACTCGC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of human SNP rs13107325 (GRCh38:chr4:102267552C>T, c.1171G>A, p.A391T) associated with schizophrenia. (J:342738)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Slc39a8 Mutation: 43 strains or lines available

References

• Original: J:342738 Li S, et al., The schizophrenia-associated missense variant rs13107325 regulates dendritic spine density. Transl Psychiatry. 2022 Sep 2;12(1):361
• All: 1 reference(s)