Pklr^em1Appsc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pklr^em1Appsc
• Name: pyruvate kinase liver and red blood cell; endonuclease-mediated mutation 1, Applied StemCell
• MGI ID: MGI:7572604
• Synonyms: Pklr^-, Pklr KO
• Gene: Pklr Location: Chr3:89043449-89054091 bp, + strand Genetic Position: Chr3, 39.01 cM
• Alliance: Pklr^em1Appsc page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified isoform(s), Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: A single nucleotide (G) was deleted from alternative exon 1 (from MetGlu codons ATGGAA) using sgRNAs (targeting ACAGCAGGTACGCAGCAGTATGG and CAGGTACGCAGCAGTATGGAAGG) and an ssODN template with CRISPR/Cas9 technology. This knockout mutation only affects the transcript encoding the shorter liver-specific L-isozyme, which uses an alternative 1st exon downstream from the longer R-isozyme encoding transcript's exon 1. (J:342736)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pklr Mutation: 25 strains or lines available

References

• Original: J:342736 Zhang C, et al., Discovery of therapeutic agents targeting PKLR for NAFLD using drug repositioning. EBioMedicine. 2022 Aug 18;83:104214
• All: 1 reference(s)