Tfeb^em1Xinli
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tfeb^em1Xinli
• Name: transcription factor EB; endonuclease-mediated mutation 1, Xinjian Li
• MGI ID: MGI:7572842
• Synonyms: TFEB C270S
• Gene: Tfeb Location: Chr17:48047962-48103341 bp, + strand Genetic Position: Chr17, 23.99 cM, cytoband D
• Alliance: Tfeb^em1Xinli page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Single point mutation
• Mutation details: Cysteine codon 270 (TGC) in exon 4 was changed to serine (AGC) (p.C270S) using an sgRNA (targeting GCTTCTGAGTCAGGTCGGCA) and an ssODN template with CRISPR/Cas9 technology. The mutation blocks alkylation of the residue in the encoded peptide. (J:342735)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tfeb Mutation: 45 strains or lines available

References

• Original: J:342735 Zhang Z, et al., Itaconate is a lysosomal inducer that promotes antibacterial innate immunity. Mol Cell. 2022 Aug 4;82(15):2844-2857.e10
• All: 1 reference(s)