Morc2a^em1Snupy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Morc2a^em1Snupy
• Name: microrchidia 2A; endonuclease-mediated mutation 1, Su Cheong Yeom
• MGI ID: MGI:7579187
• Synonyms: Morc2a S87L
• Gene: Morc2a Location: Chr11:3599191-3640477 bp, + strand Genetic Position: Chr11, 2.56 cM
• Alliance: Morc2a^em1Snupy page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Serine codon 87 (TCA) in exon 6 was changed to leucine (TTA) (c.C260T, p.S87L) using sgRNAs (targeting AGTGGACTCAGGAGTTCTTTTGG and TTTTGGCTGACTTCCCAAACTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with Charcot-Marie-Tooth disease type 2Z (CMT2Z) and developmental delay, impaired growth, dysmorphic facies and axonal neuropathy (DIGFAN). (J:341847)

Disease models

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Morc2a Mutation: 59 strains or lines available

References

• Original: J:341847 Lee GS, et al., Morc2a p.S87L mutant mice develop peripheral and central neuropathies associated with neuronal DNA damage and apoptosis. Dis Model Mech. 2021 Oct 1;14(10):dmm049123
• All: 1 reference(s)