Chchd10^em3Dpn
Endonuclease-mediated Allele Detail

Summary

• Symbol: Chchd10^em3Dpn
• Name: coiled-coil-helix-coiled-coil-helix domain containing 10; endonuclease-mediated mutation 3, Derek P Narendra
• MGI ID: MGI:7579274
• Synonyms: C10^G58R
• Gene: Chchd10 Location: Chr10:75768964-75773581 bp, + strand Genetic Position: Chr10, 38.62 cM
• Alliance: Chchd10^em3Dpn page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Glycine codon 54 (GGC) was changed to arginine (AGA) (p.G54R) using an sgRNA (targeting TAGCCGTGGGCTCAGCTGTAGGG) and an ssODN templete using CRISPR/Cas9 technology. The mutation is the equivalent of the human p.G58R mutation found in a family with mitochondrial myopathy. (J:344465)

Disease models

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Chchd10 Mutation: 17 strains or lines available

References

• Original: J:344465 Shammas MK, et al., OMA1 mediates local and global stress responses against protein misfolding in CHCHD10 mitochondrial myopathy. J Clin Invest. 2022 Jul 15;132(14):e157504
• All: 2 reference(s)