Crlf3^em1Gtm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Crlf3^em1Gtm
• Name: cytokine receptor-like factor 3; endonuclease-mediated mutation 1, David H Gutmann
• MGI ID: MGI:7608098
• Synonyms: CRLF3^L389P
• Gene: Crlf3 Location: Chr11:79937319-79971817 bp, - strand Genetic Position: Chr11, 47.43 cM
• Alliance: Crlf3^em1Gtm page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Leucine codon 389 (CTA) in exon 8 was changed to proline (CCA) (c.1166T>C:p.L389P) using sgRNAs (targeting GGAACTTCTAACAGCCATGA and GATATCGAAGCTGTGACTCT) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with higher autism burden in neurofibromatosis type 1 (NF1) patients. (J:344359)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Crlf3 Mutation: 51 strains or lines available

References

• Original: J:344359 Wilson AF, et al., A common single nucleotide variant in the cytokine receptor-like factor-3 (CRLF3) gene causes neuronal deficits in human and mouse cells. Hum Mol Genet. 2023 Dec 1;32(24):3342-3352
• All: 1 reference(s)