Cdc23^em1Lwa
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdc23^em1Lwa
• Name: CDC23 cell division cycle 23; endonuclease-mediated mutation 1, Lei Wang
• MGI ID: MGI:7608105
• Synonyms: Cdc23^Y329C
• Gene: Cdc23 Location: Chr18:34764004-34784788 bp, - strand Genetic Position: Chr18, 18.69 cM
• Alliance: Cdc23^em1Lwa page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Tyrosine codon 329 (TAC) in exon 9 was changed to cysteine (TGC) (p.Y329C) using an sgRNA (targeting GGTATTTATCAATTTCACAGAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with female infertility characterized by oocyte maturation defects. (J:344361)

Disease models

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cdc23 Mutation: 57 strains or lines available

References

• Original: J:344361 Fan H, et al., Homozygous variants in CDC23 cause female infertility characterized by oocyte maturation defects. Hum Genet. 2023 Nov;142(11):1621-1631
• All: 1 reference(s)