Thoc6^em1Schaf
Endonuclease-mediated Allele Detail

Summary

• Symbol: Thoc6^em1Schaf
• Name: THO complex 6; endonuclease-mediated mutation 1, Ashleigh Schaffer
• MGI ID: MGI:7610212
• Synonyms: Thoc6^fs
• Gene: Thoc6 Location: Chr17:23887588-23892856 bp, - strand Genetic Position: Chr17, 11.97 cM
• Alliance: Thoc6^em1Schaf page

Mutation origin

• Strain of Origin: C57BL/6JN

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Insertion
• Mutation details: CRISPR/Cas9 technology using sgRNA GCACCGCTCGCGGTGCCTCT generated an insertion into exon 1 at the sixth amino acid, a proline, resulting in a frameshift variant that generated a premature stop codon after 8 amino acids. A faint minor allele product approximately 24 amino acids shorter generated from an alternative translation initiation site 73 nucleotides downstream of the wild-type start site is detected in heterozygotes in Western blot analysis and is faintly detected in homozygotes by E9.5 but not at E8.5. (J:345604)

Expression

In Mice Carrying this Mutation:	1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Thoc6 Mutation: 32 strains or lines available

References

• Original: J:345604 Werren EA, et al., TREX tetramer disruption alters RNA processing necessary for corticogenesis in THOC6 Intellectual Disability Syndrome. Nat Commun. 2024 Feb 22;15(1):1640
• All: 1 reference(s)