About   Help   FAQ
Thoc6em1Schaf
Endonuclease-mediated Allele Detail
Summary
Symbol: Thoc6em1Schaf
Name: THO complex 6; endonuclease-mediated mutation 1, Ashleigh Schaffer
MGI ID: MGI:7610212
Synonyms: Thoc6fs
Gene: Thoc6  Location: Chr17:23887588-23892856 bp, - strand  Genetic Position: Chr17, 11.97 cM
Alliance: Thoc6em1Schaf page
Mutation
origin
Strain of Origin:  C57BL/6JN
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Insertion
 
Mutation detailsCRISPR/Cas9 technology using sgRNA GCACCGCTCGCGGTGCCTCT generated an insertion into exon 1 at the sixth amino acid, a proline, resulting in a frameshift variant that generated a premature stop codon after 8 amino acids. A faint minor allele product approximately 24 amino acids shorter generated from an alternative translation initiation site 73 nucleotides downstream of the wild-type start site is detected in heterozygotes in Western blot analysis and is faintly detected in homozygotes by E9.5 but not at E8.5. (J:345604)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 28 assay results
1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Thoc6 Mutation:  32 strains or lines available
References
Original:  J:345604 Werren EA, et al., TREX tetramer disruption alters RNA processing necessary for corticogenesis in THOC6 Intellectual Disability Syndrome. Nat Commun. 2024 Feb 22;15(1):1640
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory