Ezh2em1Jiaf
Endonuclease-mediated Allele Detail
|
Symbol: |
Ezh2em1Jiaf |
Name: |
enhancer of zeste 2 polycomb repressive complex 2 subunit; endonuclease-mediated mutation 1, Jill A Fahrner |
MGI ID: |
MGI:7610894 |
Synonyms: |
Ezh2R684C |
Gene: |
Ezh2 Location: Chr6:47507073-47572275 bp, - strand Genetic Position: Chr6, 22.92 cM, cytoband B
|
Alliance: |
Ezh2em1Jiaf page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Humanized sequence, Null/knockout) |
Mutation: |
|
Nucleotide substitutions
|
|
|
Mutation details: Arginine codon 679 (CGA) in exon 18 was changed to cysteine (TGT) (ENSMUSP00000080419:p.R679C) using an sgRNA (targeting GTGGTGGATGCAACCCGAAA) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the SET domain of the encoded peptide, is the equivalent of the human c.2050C>T:p.R684C mutation associated with Weaver syndrome and results in a catalytically defective enzyme. Mouse embryonic fibroblasts (MEFs) produce normal levels of the mutant protein.
(J:345603)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Ezh2 Mutation: |
71 strains or lines available
|
|
Original: |
J:345603 Gao CW, et al., A mouse model of Weaver syndrome displays overgrowth and excess osteogenesis reversible with KDM6A/6B inhibition. JCI Insight. 2024 Jan 9;9(1) |
All: |
1 reference(s) |
|