Ezh2^em1Jiaf
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ezh2^em1Jiaf
• Name: enhancer of zeste 2 polycomb repressive complex 2 subunit; endonuclease-mediated mutation 1, Jill A Fahrner
• MGI ID: MGI:7610894
• Synonyms: Ezh2^R684C
• Gene: Ezh2 Location: Chr6:47507073-47572275 bp, - strand Genetic Position: Chr6, 22.92 cM, cytoband B
• Alliance: Ezh2^em1Jiaf page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence, Null/knockout)
• Mutation: Nucleotide substitutions
• Mutation details: Arginine codon 679 (CGA) in exon 18 was changed to cysteine (TGT) (ENSMUSP00000080419:p.R679C) using an sgRNA (targeting GTGGTGGATGCAACCCGAAA) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the SET domain of the encoded peptide, is the equivalent of the human c.2050C>T:p.R684C mutation associated with Weaver syndrome and results in a catalytically defective enzyme. Mouse embryonic fibroblasts (MEFs) produce normal levels of the mutant protein. (J:345603)

Disease models

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ezh2 Mutation: 72 strains or lines available

References

• Original: J:345603 Gao CW, et al., A mouse model of Weaver syndrome displays overgrowth and excess osteogenesis reversible with KDM6A/6B inhibition. JCI Insight. 2024 Jan 9;9(1)
• All: 1 reference(s)