About   Help   FAQ
Cdca7em1Ldax
Endonuclease-mediated Allele Detail
Summary
Symbol: Cdca7em1Ldax
Name: cell division cycle associated 7; endonuclease-mediated mutation 1, Lucia Daxinger
MGI ID: MGI:7614313
Synonyms: Cdca7G305V
Gene: Cdca7  Location: Chr2:72306540-72317237 bp, + strand  Genetic Position: Chr2, 43.35 cM
Alliance: Cdca7em1Ldax page
Mutation
origin
Strain of Origin:  FVB/NJ-Tg(HBA1-GFP)1Ew/Ew
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsGlycine codon 305 (GGC) in exon 7 was changed to valine (GTC) (c.914G>T;p.G305V) using an sgRNA(targeting AGGGACCACAGAATTGGCCCCGG) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the carboxyterminal 4-CXXCtype zinc finger (ZF) domain of the encoded peptide, is the equivalent of the human c.881G>T; p.Gly294Val mutation associated with immunodeficiency, centromeric instability, facial anomalies syndrome 3 (ICF3). (J:345314)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 2 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Cdca7 Mutation:  27 strains or lines available
References
Original:  J:345314 Vukic M, et al., CDCA7-associated global aberrant DNA hypomethylation translates to localized, tissue-specific transcriptional responses. Sci Adv. 2024 Feb 9;10(6):eadk3384
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory