Klk11^em1Zlin
Endonuclease-mediated Allele Detail

Summary

• Symbol: Klk11^em1Zlin
• Name: kallikrein related-peptidase 11; endonuclease-mediated mutation 1, Zhimiao Lin
• MGI ID: MGI:7614790
• Synonyms: Klk11^G44E
• Gene: Klk11 Location: Chr7:43424041-43428687 bp, + strand Genetic Position: Chr7, 28.26 cM
• Alliance: Klk11^em1Zlin page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Glycine codon 44 (GGA) in exon 3 was changed to glutamic acid (GAA) (c.131G>A:p.G44E) using an sgRNA (targeting GGAGAGACGAGGATCATCAA) and an ssODN template with CRISPR/Cas9 technology. The mutation, at the C-terminal edge of the signal peptide sequence of the encoded peptide, is the equivalent of the human c.149G>A (p.G50E) mutation associated with autosomal-dominant cornification disorder characterized by abnormal skin desquamation. The mutation interferes with signal peptide cleavage, leading to mislocalization of the protein. (J:345142)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Klk11 Mutation: 22 strains or lines available

References

• Original: J:345142 Gong Z, et al., Variants in KLK11, affecting signal peptide cleavage of kallikrein-related peptidase 11, cause an autosomal-dominant cornification disorder. Br J Dermatol. 2023 Jan 23;188(1):100-111
• All: 1 reference(s)