About   Help   FAQ
Klk11em1Zlin
Endonuclease-mediated Allele Detail
Summary
Symbol: Klk11em1Zlin
Name: kallikrein related-peptidase 11; endonuclease-mediated mutation 1, Zhimiao Lin
MGI ID: MGI:7614790
Synonyms: Klk11G44E
Gene: Klk11  Location: Chr7:43424041-43428687 bp, + strand  Genetic Position: Chr7, 28.26 cM
Alliance: Klk11em1Zlin page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsGlycine codon 44 (GGA) in exon 3 was changed to glutamic acid (GAA) (c.131G>A:p.G44E) using an sgRNA (targeting GGAGAGACGAGGATCATCAA) and an ssODN template with CRISPR/Cas9 technology. The mutation, at the C-terminal edge of the signal peptide sequence of the encoded peptide, is the equivalent of the human c.149G>A (p.G50E) mutation associated with autosomal-dominant cornification disorder characterized by abnormal skin desquamation. The mutation interferes with signal peptide cleavage, leading to mislocalization of the protein. (J:345142)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Klk11 Mutation:  22 strains or lines available
References
Original:  J:345142 Gong Z, et al., Variants in KLK11, affecting signal peptide cleavage of kallikrein-related peptidase 11, cause an autosomal-dominant cornification disorder. Br J Dermatol. 2023 Jan 23;188(1):100-111
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/09/2024
MGI 6.24
The Jackson Laboratory