Klk5^em1Mer
Endonuclease-mediated Allele Detail

Summary

• Symbol: Klk5^em1Mer
• Name: kallikrein related-peptidase 5; endonuclease-mediated mutation 1, Marc E Rothenberg
• MGI ID: MGI:7614802
• Gene: Klk5 Location: Chr7:43491395-43500605 bp, + strand Genetic Position: Chr7, 28.3 cM
• Alliance: Klk5^em1Mer page

Mutation origin

• Strain of Origin: BALB/c

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology generated a 37 bp deletion (CCCTGGAAATGGGCAATGGCTACCCTGATCACAACCC) in exon 1. qRT-PCR confirmed undetectable mRNA expression in the esophagus. (J:344772)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Klk5 Mutation: 23 strains or lines available

References

• Original: J:344772 Azouz NP, et al., Functional role of kallikrein 5 and proteinase-activated receptor 2 in eosinophilic esophagitis. Sci Transl Med. 2020 May 27;12(545):eaaz7773
• All: 1 reference(s)