Alpk1^em1Dlka
Endonuclease-mediated Allele Detail

Summary

• Symbol: Alpk1^em1Dlka
• Name: alpha-kinase 1; endonuclease-mediated mutation 1, Daniel L Kastner
• MGI ID: MGI:7614851
• Synonyms: Alpk1^T237M
• Gene: Alpk1 Location: Chr3:127463959-127574176 bp, - strand Genetic Position: Chr3, 56.54 cM, cytoband H1
• Alliance: Alpk1^em1Dlka page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Threonine codon 237 (ACA) in exon 9 was changed to methionine (ATG) (p.T237M) using an sgRNA (targeting ACAGGGCATTTCCACATCAC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with ROSAH (retinal dystrophy, optic nerve oedema, splenomegaly, anhidrosis and headache) syndrome. (J:344848)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Alpk1 Mutation: 78 strains or lines available

References

• Original: J:344848 Kozycki CT, et al., Gain-of-function mutations in ALPK1 cause an NF-kappaB-mediated autoinflammatory disease: functional assessment, clinical phenotyping and disease course of patients with ROSAH syndrome. Ann Rheum Dis. 2022 Oct;81(10):1453-1464
• All: 1 reference(s)