Mbtps2^em1Sapo
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mbtps2^em1Sapo
• Name: membrane-bound transcription factor peptidase, site 2; endonuclease-mediated mutation 1, Sandra Pohl
• MGI ID: MGI:7614892
• Synonyms: Mbtps2^N455S
• Gene: Mbtps2 Location: ChrX:156330818-156381711 bp, - strand Genetic Position: ChrX, 72.55 cM
• Alliance: Mbtps2^em1Sapo page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Asparagine codon 455 (AAT) in exon 11 was changed to serine (AGT) (c.1364A>G:p.N455S) using an sgRNA (targeting TTGACCATCCAAGGCAAAGC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human c.1376A>G (p.N459S) mutation associated with X-linked osteogenesis imperfecta (OI). (J:344727)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mbtps2 Mutation: 13 strains or lines available

References

• Original: J:344727 Danyukova T, et al., Mice heterozygous for an osteogenesis imperfecta-linked MBTPS2 variant display a compromised subchondral osteocyte lacunocanalicular network associated with abnormal articular cartilage. Bone. 2023 Dec;177:116927
• All: 1 reference(s)