Mbtps2^em2Sapo
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mbtps2^em2Sapo
• Name: membrane-bound transcription factor peptidase, site 2; endonuclease-mediated mutation 2, Sandra Pohl
• MGI ID: MGI:7614893
• Synonyms: Mbtps2^ko
• Gene: Mbtps2 Location: ChrX:156330818-156381711 bp, - strand Genetic Position: ChrX, 72.55 cM
• Alliance: Mbtps2^em2Sapo page

Mutation origin

• Strain of Origin: (C57BL/6J x CBA)F1

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Insertion
• Mutation details: Exon 2 was targeted by an sgRNA (targeting GTTGGGGACGGCGGAAAGCA) using CRISPR/Cas9 technology, resulting in the insertion of a single nucleotide (c.204_205insC), leading to a frameshift and premature stop codon (p.A69Rfs*40). (J:344727)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mbtps2 Mutation: 13 strains or lines available

References

• Original: J:344727 Danyukova T, et al., Mice heterozygous for an osteogenesis imperfecta-linked MBTPS2 variant display a compromised subchondral osteocyte lacunocanalicular network associated with abnormal articular cartilage. Bone. 2023 Dec;177:116927
• All: 1 reference(s)