Fxn^em8Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fxn^em8Lutzy
• Name: frataxin; endonuclease-mediated mutation 8, Cathy Lutz
• MGI ID: MGI:7616951
• Synonyms: Fxn^G127V
• Gene: Fxn Location: Chr19:24238817-24257969 bp, - strand Genetic Position: Chr19, 19.39 cM, cytoband C1
• Alliance: Fxn^em8Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Glycine codon 127 (GGC) in exon 4 was changed to valine (GTC) (c.380G>T:p.G127V) using an sgRNA (equivalent to TGCCACCTGACCCCCTAGGA) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the c.389G>T:p.G130V human mutation associated with Friedreich ataxia (FRDA). Transcription from this allele is normal, but translation is at about 5% of normal. (J:299300)

Disease models

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Fxn Mutation: 42 strains or lines available

References

• Original: J:299300 Fil D, et al., Mitochondrial damage and senescence phenotype of cells derived from a novel frataxin G127V point mutation mouse model of Friedreich's ataxia. Dis Model Mech. 2020 Jun 25;:dmm045229
• All: 2 reference(s)