Garin2^em1Maq
Endonuclease-mediated Allele Detail

Summary

• Symbol: Garin2^em1Maq
• Name: golgi associated RAB2 interactor 2; endonuclease-mediated mutation 1, Qian Ma
• MGI ID: MGI:7620297
• Synonyms: FAM71D^-
• Gene: Garin2 Location: Chr12:78738309-78781290 bp, + strand Genetic Position: Chr12, 35.51 cM, cytoband D2
• Alliance: Garin2^em1Maq page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using gRNAs GCTTAGGAAATGGGGGGTTG and TAGTGAATCCTTCTGACAAA generated a 73 bp deletion in exon 4, which resulted in the mutation of valine at amino acid 70 to leucine and a frameshift mutation that causes a premature stop at amino acid 82. Western blot analysis and immunofluorescence confirmed absence of protein in testis lysates. (J:344724)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Garin2 Mutation: 32 strains or lines available

References

• Original: J:344724 Mo S, et al., FAM71D is dispensable for spermatogenesis and male fertility in mice. Mol Reprod Dev. 2023 Dec;90(12):804-809
• All: 1 reference(s)