Tfap2b^em2Sleep
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tfap2b^em2Sleep
• Name: transcription factor AP-2 beta; endonuclease-mediated mutation 2, Yu Hayashi
• MGI ID: MGI:7627104
• Synonyms: Tfap2b^K145
• Gene: Tfap2b Location: Chr1:19279138-19308800 bp, + strand Genetic Position: Chr1, 6.19 cM, cytoband A2-A4
• Alliance: Tfap2b^em2Sleep page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: A G>C mutation (c.822-1G>C) was created in intron 4 using an sgRNA (equivalent to TTTTCGATTTGGCTCTGCAG) and an ssODN template with CRISPR/Cas9 technology. The mutation, which changes exon 5 splice acceptor site CAG to CAC, is the equivalent of the same human mutation associated with short sleep in a Char syndrome patient. Transcription from this allele is very low and splicing is aberrant. (J:297685)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tfap2b Mutation: 29 strains or lines available

References

• Original: J:297685 Nakai A, et al., Sleep Architecture in Mice Is Shaped by the Transcription Factor AP-2beta. Genetics. 2020 Nov;216(3):753-764
• All: 1 reference(s)