About   Help   FAQ
Tfap2bem2Sleep
Endonuclease-mediated Allele Detail
Summary
Symbol: Tfap2bem2Sleep
Name: transcription factor AP-2 beta; endonuclease-mediated mutation 2, Yu Hayashi
MGI ID: MGI:7627104
Synonyms: Tfap2bK145
Gene: Tfap2b  Location: Chr1:19279138-19308800 bp, + strand  Genetic Position: Chr1, 6.19 cM, cytoband A2-A4
Alliance: Tfap2bem2Sleep page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsA G>C mutation (c.822-1G>C) was created in intron 4 using an sgRNA (equivalent to TTTTCGATTTGGCTCTGCAG) and an ssODN template with CRISPR/Cas9 technology. The mutation, which changes exon 5 splice acceptor site CAG to CAC, is the equivalent of the same human mutation associated with short sleep in a Char syndrome patient. Transcription from this allele is very low and splicing is aberrant. (J:297685)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Tfap2b Mutation:  29 strains or lines available
References
Original:  J:297685 Nakai A, et al., Sleep Architecture in Mice Is Shaped by the Transcription Factor AP-2beta. Genetics. 2020 Nov;216(3):753-764
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/17/2024
MGI 6.24
The Jackson Laboratory