Gt(ROSA)26Sor^{em1(ACE2)Brle}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gt(ROSA)26Sor^{em1(ACE2)Brle}
• Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Brendan Lee
• MGI ID: MGI:7628005
• Synonyms: Rosa26^hACE2
• Gene: Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
• Alliance: Gt(ROSA)26Sor^{em1(ACE2)Brle} page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, Inserted expressed sequence)
• Mutation: Insertion
• Gt(ROSA)26Sor^{em1(ACE2)Brle} expresses 1 gene
  Knock-in expresses:
  

  Organism

  Expressed Gene

  Homolog in Mouse

  Note

  human

  ACE2 (59272)

  Ace2	(MGI:1917258)

  conditional

• Mutation details: Using CRISPR/Cas9 endonuclease-genome editing, a guide RNA [ACTCCAGTCTTTCTAGAAGA (PAM: TGG)] was selected to introduce a loxP-flanked STOP (with stop codons in all 3 reading frames and a triple polyA signal) cassette, human angiotensin converting enzyme 2 (ACE2) cDNA, and a polyA signal sequence, into the Gt(ROSA)26Sor locus. (J:347762)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gt(ROSA)26Sor Mutation: 958 strains or lines available

References

• Original: J:347762 Song IW, et al., Generation of a humanized mAce2 and a conditional hACE2 mouse models permissive to SARS-COV-2 infection. Mamm Genome. 2024 Mar 15
• All: 1 reference(s)