Camk2d^em1Mean
Endonuclease-mediated Allele Detail

Summary

• Symbol: Camk2d^em1Mean
• Name: calcium/calmodulin-dependent protein kinase II, delta; endonuclease-mediated mutation 1, Mark E Anderson
• MGI ID: MGI:7628184
• Synonyms: CaMKIIdelta^M308V
• Gene: Camk2d Location: Chr3:126389951-126639975 bp, + strand Genetic Position: Chr3, 55.97 cM
• Alliance: Camk2d^em1Mean page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Single point mutation
• Mutation details: Methionine codon 308 (ATG) in exon 12 was changed to valine (GTG) (p.M308V) using an sgRNA (equivalent to CGCCATCTTGACAACTATGCTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the calmodulin-binding domain of the encoded peptide, reduces calmodulin binding and kinase activity. (J:299988)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Camk2d Mutation: 44 strains or lines available

References

• Original: J:299988 Konstantinidis K, et al., MICAL1 constrains cardiac stress responses and protects against disease by oxidizing CaMKII. J Clin Invest. 2020 Sep 1;130(9):4663-4678
• All: 1 reference(s)