Akr1c21^em1Wany
Endonuclease-mediated Allele Detail

Summary

• Symbol: Akr1c21^em1Wany
• Name: aldo-keto reductase family 1, member C21; endonuclease-mediated mutation 1, Yanli Wang
• MGI ID: MGI:7639885
• Gene: Akr1c21 Location: Chr13:4624074-4636540 bp, + strand Genetic Position: Chr13, 2.56 cM
• Alliance: Akr1c21^em1Wany page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details: CRISPR/cas9 mediated recombination using guide RNAs (forward 5'GCATCTCAAGAAAAAGTCTA3' and reverse 3'CGTAGAGTTCTTTTTCAGAT5') created a null allele. (J:322353)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Akr1c21 Mutation: 26 strains or lines available

References

• Original: J:322353 Wang X, et al., AKR1C1 alleviates LPSinduced ALI in mice by activating the JAK2/STAT3 signaling pathway. Mol Med Rep. 2021 Dec;24(6)
• All: 1 reference(s)