Zdhhc5^em1Eko
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zdhhc5^em1Eko
• Name: zinc finger, DHHC domain containing 5; endonuclease-mediated mutation 1, Eryan Kong
• MGI ID: MGI:7639940
• Gene: Zdhhc5 Location: Chr2:84518314-84545524 bp, - strand Genetic Position: Chr2, 49.45 cM
• Alliance: Zdhhc5^em1Eko page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 mediated recombination using guide RNAs (TTGTAAGCTGATTGATGTACAGG, GCTTAATTAGTGAAGGCATCAGG) created a 5885 bp deletion spanning exons 5 - 11. (J:329241)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Zdhhc5 Mutation: 31 strains or lines available

References

• Original: J:329241 Yan P, et al., Crosstalk of Synapsin1 palmitoylation and phosphorylation controls the dynamicity of synaptic vesicles in neurons. Cell Death Dis. 2022 Sep 12;13(9):786
• All: 1 reference(s)