Msln^em2Strom
Endonuclease-mediated Allele Detail

Summary

• Symbol: Msln^em2Strom
• Name: mesothelin; endonuclease-mediated mutation 2, Ingunn Stromnes
• MGI ID: MGI:7645424
• Synonyms: Msln^-
• Gene: Msln Location: Chr17:25967587-25973352 bp, - strand Genetic Position: Chr17, 12.85 cM, cytoband A3.3
• Alliance: Msln^em2Strom page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Using CRISPR/Cas9 technology, SgRNAs recognizing exon 4 of Msln (GGCCAAGAAAGAGGCCUGUG; +25753054; ENSMUST00000238120) were targetted result in Msln indel causing disruption. (J:333043)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Msln Mutation: 36 strains or lines available

References

• Original: J:333043 Rollins MR, et al., Germline T cell receptor exchange results in physiological T cell development and function. Nat Commun. 2023 Feb 1;14(1):528
• All: 1 reference(s)