Helq^em1Eljt
Endonuclease-mediated Allele Detail

Summary

• Symbol: Helq^em1Eljt
• Name: helicase, POLQ-like; endonuclease-mediated mutation 1, Elena J Tucker
• MGI ID: MGI:7645530
• Synonyms: Helq^KI
• Gene: Helq Location: Chr5:100910011-100946464 bp, - strand Genetic Position: Chr5, 48.52 cM, cytoband E
• Alliance: Helq^em1Eljt page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Glutamine codon 161 (CAA) in exon 2 was changed to proline (CCT) (p.Q161P) using an sgRNA (equivalent to AAGTATAAAATTTGAGAAGA) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human c.596 A>C; p.Q199P mutation associated with disrupted ovarian function (primary/premature ovarian insufficiency, POI) and female infertility. (J:347863)

Disease models

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Helq Mutation: 47 strains or lines available

References

• Original: J:347863 Bakhshalizadeh S, et al., A Human Homozygous HELQ Missense Variant Does Not Cause Premature Ovarian Insufficiency in a Mouse Model. Genes (Basel). 2024 Mar 4;15(3)
• All: 1 reference(s)