Dph1^em1Swei
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dph1^em1Swei
• Name: diphthamide biosynthesis 1; endonuclease-mediated mutation 1, Shuo Wei
• MGI ID: MGI:7645689
• Synonyms: Dph1^Q41X
• Gene: Dph1 Location: Chr11:75068469-75081309 bp, - strand Genetic Position: Chr11, 45.76 cM
• Alliance: Dph1^em1Swei page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence, Null/knockout)
• Mutation: Single point mutation
• Mutation details: Glutamine codon 41 (CAG) in exon 2 was changed to a stop codon (TAG) (c.121C>T:p.Q41*) using an sgRNA (equivalent to CCAGTTACAGGCTGCTGTCCAAG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.Q46* mutation found in a patient with diphthamide deficiency syndrome 1 (developmental delay with short stature, dysmorphic facial features, and sparse hair 1, DEDSSH1). (J:347602)

Disease models

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Dph1 Mutation: 27 strains or lines available

References

• Original: J:347602 Shi Y, et al., Diphthamide deficiency promotes association of eEF2 with p53 to induce p21 expression and neural crest defects. Nat Commun. 2024 Apr 26;15(1):3301
• All: 1 reference(s)