About   Help   FAQ
Dph1em1Swei
Endonuclease-mediated Allele Detail
Summary
Symbol: Dph1em1Swei
Name: diphthamide biosynthesis 1; endonuclease-mediated mutation 1, Shuo Wei
MGI ID: MGI:7645689
Synonyms: Dph1Q41X
Gene: Dph1  Location: Chr11:75068469-75081309 bp, - strand  Genetic Position: Chr11, 45.76 cM
Alliance: Dph1em1Swei page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence, Null/knockout)
Mutation:    Single point mutation
 
Mutation detailsGlutamine codon 41 (CAG) in exon 2 was changed to a stop codon (TAG) (c.121C>T:p.Q41*) using an sgRNA (equivalent to CCAGTTACAGGCTGCTGTCCAAG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.Q46* mutation found in a patient with diphthamide deficiency syndrome 1 (developmental delay with short stature, dysmorphic facial features, and sparse hair 1, DEDSSH1). (J:347602)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Dph1 Mutation:  27 strains or lines available
References
Original:  J:347602 Shi Y, et al., Diphthamide deficiency promotes association of eEF2 with p53 to induce p21 expression and neural crest defects. Nat Commun. 2024 Apr 26;15(1):3301
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory