Cdkn1a^em1Swei
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdkn1a^em1Swei
• Name: cyclin dependent kinase inhibitor 1A; endonuclease-mediated mutation 1, Shuo Wei
• MGI ID: MGI:7645691
• Synonyms: p21 KO
• Gene: Cdkn1a Location: Chr17:29309953-29319696 bp, + strand Genetic Position: Chr17, 15.12 cM
• Alliance: Cdkn1a^em1Swei page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 2 was targeted with sgRNAs (targeting GAGTTAATCACCAAGACAGCAGG and TGGCAGTAGAGCTCTAAGAAGGG) using CRISPR/Cas9 technology, resulting in a 975 bp deletion. (J:347602)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cdkn1a Mutation: 60 strains or lines available

References

• Original: J:347602 Shi Y, et al., Diphthamide deficiency promotes association of eEF2 with p53 to induce p21 expression and neural crest defects. Nat Commun. 2024 Apr 26;15(1):3301
• All: 1 reference(s)