App^em1Aduci
Endonuclease-mediated Allele Detail

Summary

• Symbol: App^em1Aduci
• Name: amyloid beta precursor protein; endonuclease-mediated mutation 1, Frank LaFerla
• MGI ID: MGI:7645709
• Gene: App Location: Chr16:84751236-84972187 bp, - strand Genetic Position: Chr16, 46.92 cM, cytoband C3-qter
• Alliance: App^em1Aduci page

Mutation origin

• Strain of Origin: B6(Cg)-App^tm1.1Aduci/J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: A guide RNA (AGAGATCTCGGAAGTGAAGA) was designed to produce the KM670/671NL (Swedish) mutations in exon 16 of the amyloid beta precursor protein (App) gene. Specifically, the mutations change a lysine (K) and methionine (M) in APP to asparagine (N) and leucine (L). This targetted mutation was made in App zygote containing a loxP site upstream of exon 14, 3 point mutations inserted into exon 14 to create amino acid substitutions (amino acids 5 (G->R), 10 (F->Y) and 13 (R->H)) (ENSMUSE00000131684), a loxP site downstream of exon 14. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any App Mutation: 91 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)