Aifm3^em1Jgg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Aifm3^em1Jgg
• Name: apoptosis-inducing factor, mitochondrion-associated 3; endonuclease-mediated mutation 1, Joseph G Gleeson
• MGI ID: MGI:7660785
• Gene: Aifm3 Location: Chr16:17307475-17325349 bp, + strand Genetic Position: Chr16, 10.84 cM
• Alliance: Aifm3^em1Jgg page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology targeting the intron 3-exon 4 junction using gRNAs UUCAAUCUUGAGCUCCACUG and GUGCUGCCAGAGAAAGAGCG generated a 9 bp deletion (chr16:17317404 GTCCACAGTG > G), resulting in a splice acceptor deletion and subsequently frameshift mutation. (J:348704)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Aifm3 Mutation: 21 strains or lines available

References

• Original: J:348704 Vong KI, et al., Risk of meningomyelocele mediated by the common 22q11.2 deletion. Science. 2024 May 3;384(6695):584-590
• All: 1 reference(s)