Pi4ka^em1Jgg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pi4ka^em1Jgg
• Name: phosphatidylinositol 4-kinase alpha; endonuclease-mediated mutation 1, Joseph G Gleeson
• MGI ID: MGI:7660787
• Gene: Pi4ka Location: Chr16:17098215-17224178 bp, - strand Genetic Position: Chr16, 10.71 cM
• Alliance: Pi4ka^em1Jgg page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Insertion
• Mutation details: CRISPR/Cas9 technology using gRNAs AUGGGAUCGCAUACUUGCAA and CUUGAGAUUCCUAUCAGGCA generated a 1 bp insertion (chr16:17195031 G>GG) in exon 6 resulting in a premature stop codon (p.Lys123GInfsTer52). (J:348704)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pi4ka Mutation: 126 strains or lines available

References

• Original: J:348704 Vong KI, et al., Risk of meningomyelocele mediated by the common 22q11.2 deletion. Science. 2024 May 3;384(6695):584-590
• All: 1 reference(s)