Meis1^em1Rihw
Endonuclease-mediated Allele Detail

Summary

• Symbol: Meis1^em1Rihw
• Name: Meis homeobox 1; endonuclease-mediated mutation 1, Rhiannan H Williams
• MGI ID: MGI:7664086
• Synonyms: Meis1^R272H
• Gene: Meis1 Location: Chr11:18830428-18968992 bp, - strand Genetic Position: Chr11, 11.11 cM
• Alliance: Meis1^em1Rihw page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Arginine codon 272 (CGT) in exon 8 was changed to histidine (CAT) (p.R272H) using an sgRNA (equivalent to AAAAAGCGTCACAAAAAGCG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human c.815G>A:p.R272H mutation found in some restless legs syndrome (RLS) patients. (J:350503)

Disease models

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Meis1 Mutation: 46 strains or lines available

References

• Original: J:350503 Leu CL, et al., A patient-enriched MEIS1 coding variant causes a restless legs syndrome-like phenotype in mice. Sleep. 2024 May 10;47(5)
• All: 1 reference(s)