Ctcf^em1Hyao
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ctcf^em1Hyao
• Name: CCCTC-binding factor; endonuclease-mediated mutation 1, Hongjie Yao
• MGI ID: MGI:7664135
• Synonyms: CTCF^R567W
• Gene: Ctcf Location: Chr8:106363200-106409554 bp, + strand Genetic Position: Chr8, 53.04 cM
• Alliance: Ctcf^em1Hyao page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Arginine codon 567 (CGG) in exon 9 was changed to tryptophan (TGG) (p.R567W) using an sgRNA (equivalent to AAACATTCACCCGCCGGGTAAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with autosomal dominant intellectual developmental disorder 21. (J:350502)

Expression

In Mice Carrying this Mutation:	37 assay results 2 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ctcf Mutation: 80 strains or lines available

References

• Original: J:350502 Zhang J, et al., CTCF mutation at R567 causes developmental disorders via 3D genome rearrangement and abnormal neurodevelopment. Nat Commun. 2024 Jul 1;15(1):5524
• All: 1 reference(s)