Ccdc28a^em1Lwa
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc28a^em1Lwa
• Name: coiled-coil domain containing 28A; endonuclease-mediated mutation 1, Lei Wang
• MGI ID: MGI:7664574
• Gene: Ccdc28a Location: Chr10:18089424-18110746 bp, - strand Genetic Position: Chr10, 7.53 cM
• Alliance: Ccdc28a^em1Lwa page

Mutation origin

• Strain of Origin: (C57BL/6 x DBA/2)F1

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using sgRNA CCAGGACCCGGTGGACCAACTGG and GGTAGCTGGAATGTTACGGTAGG deleted exon 3. Western blot analysis confirmed the absence of protein. (J:350809)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ccdc28a Mutation: 25 strains or lines available

References

• Original: J:350809 Zhou H, et al., CCDC28A deficiency causes sperm head defects, reduced sperm motility and male infertility in mice. Cell Mol Life Sci. 2024 Apr 10;81(1):174
• All: 1 reference(s)