3425401B19Rik^em1Liyu
Endonuclease-mediated Allele Detail

Summary

• Symbol: 3425401B19Rik^em1Liyu
• Name: RIKEN cDNA 3425401B19 gene; endonuclease-mediated mutation 1, Yulin Li
• MGI ID: MGI:7716459
• Synonyms: mC10orf71^-
• Gene: 3425401B19Rik Location: Chr14:32381076-32407250 bp, - strand Genetic Position: Chr14, 19.4 cM
• Alliance: 3425401B19Rik^em1Liyu page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using gRNAs GGTTCTGTGAGATGCCGGTGAGG and AGAGAGGGTTTTCCTCGTGGTGG generated a 4,916 bp deletion generating a null allele. (J:350467)

Disease models

Expression

In Mice Carrying this Mutation:	25 assay results 1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any 3425401B19Rik Mutation: 63 strains or lines available

References

• Original: J:350467 Li Y, et al., Frameshift variants in C10orf71 cause dilated cardiomyopathy in human, mouse, and organoid models. J Clin Invest. 2024 Jun 17;134(12)
• All: 1 reference(s)