Snip1^em1Yiji
Endonuclease-mediated Allele Detail

Summary

• Symbol: Snip1^em1Yiji
• Name: Smad nuclear interacting protein 1; endonuclease-mediated mutation 1, Yichang Jia
• MGI ID: MGI:7738204
• Gene: Snip1 Location: Chr4:124960465-124967835 bp, + strand Genetic Position: Chr4, 57.99 cM
• Alliance: Snip1^em1Yiji page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Insertion
• Mutation details: CRISPR/Cas9 technology using gRNA AGTGAGCGAGACCGGCACCGGGG generated a 1 bp insertion (T) in exon 3 generating an out-of-frame knock-out allele. (J:354967)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Snip1 Mutation: 19 strains or lines available

References

• Original: J:354967 Meng D, et al., A molecular brake that modulates spliceosome pausing at detained introns contributes to neurodegeneration. Protein Cell. 2023 May 8;14(5):318-336
• All: 1 reference(s)