B4galt3^em1Masn
Endonuclease-mediated Allele Detail

Summary

• Symbol: B4galt3^em1Masn
• Name: UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 3; endonuclease-mediated mutation 1, Masahide Asano
• MGI ID: MGI:7780011
• Gene: B4galt3 Location: Chr1:171097898-171104468 bp, + strand Genetic Position: Chr1, 79.29 cM
• Alliance: B4galt3^em1Masn page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using gRNAs AAGGCAAGGTCAGAAATCGG and GTGGGGTAACTGTAAGACAG deleted exon 2 which contains the UDP-Gal binding site. (J:343168)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any B4galt3 Mutation: 41 strains or lines available

References

• Original: J:343168 Wei H, et al., Beta-1,4-galactosyltransferase-3 deficiency suppresses the growth of immunogenic tumors in mice. Front Immunol. 2023;14:1272537
• All: 1 reference(s)