Mir497em1Hgyu
Endonuclease-mediated Allele Detail
|
Symbol: |
Mir497em1Hgyu |
Name: |
microRNA 497; endonuclease-mediated mutation 1, Honggang Yu |
MGI ID: |
MGI:7782629 |
Gene: |
Mir497 Location: Chr11:70125543-70125626 bp, + strand Genetic Position: Chr11, 42.99 cM
|
Alliance: |
Mir497em1Hgyu page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: CRISPR/Cas9 technology using sgRNAs GCCTGCTAAACTACTTTTGC and GTTGTCTGATACCAGTTATC deleted the entire sequence.
(J:357958)
|
|
|
Key: |
hm |
homozygous |
ht |
heterozygous |
tg |
involves transgenes |
√ |
phenotype observed |
cn |
conditional genotype |
cx |
complex: > 1 genome feature |
ot |
other: hemizygous, indeterminate,... |
N |
normal phenotype |
|
Genotype/ Background: |
| Allelic Composition | Genetic Background | Cell Line(s) |
---|
Loading... | | | C57BL/6-Mir497em1Hgyu | |
|
Phenotypes: |
Affected Systems |
|
|
digestive/alimentary system
|
√
|
increased susceptibility to induced colitis
|
√
|
immune system
|
√
|
increased susceptibility to induced colitis
|
√
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Mir497 Mutation: |
2 strains or lines available
|
|
Original: |
J:357958 Zhang M, et al., MicroRNA-497 inhibits inflammation in DSS-induced IBD model mice and lipopolysaccharide-induced RAW264.7 cells via Wnt/beta-catenin pathway. Int Immunopharmacol. 2021 Dec;101(Pt B):108318 |
All: |
1 reference(s) |
|