Fam50b^em1Zfhu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fam50b^em1Zfhu
• Name: family with sequence similarity 50, member B; endonuclease-mediated mutation 1, Zhangfeng Hu
• MGI ID: MGI:7783440
• Synonyms: XAP5L^-
• Gene: Fam50b Location: Chr13:34918833-34931605 bp, + strand Genetic Position: Chr13, 14.18 cM
• Alliance: Fam50b^em1Zfhu page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using sgRNAs GGCTACCAGAAACAGGGACT and AGTTTGGGGACCTTACTCCC generated an approximate 1.4 kb deletion. Western blot analysis confirmed the absence of protein in adult homozygous testes extract. (J:357849)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Fam50b Mutation: 24 strains or lines available

References

• Original: J:357849 Wang W, et al., Control of ciliary transcriptional programs during spermatogenesis by antagonistic transcription factors. Elife. 2024
• All: 1 reference(s)