Rr504^em4Takas
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr504^em4Takas
• Name: regulatory region 504; endonuclease-mediated mutation 4, Shuji Takada
• MGI ID: MGI:7787033
• Synonyms: SOX9 BS^sub/SRY BS^sub
• Gene: Rr504 Location: Chr11:112108104-112108661 bp Genetic Position: Chr11, Syntenic
• Alliance: Rr504^em4Takas page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Nucleotide substitutions
• Mutation details: The SRY-binding site TCTAAACAA (GRCm39:chr11:112108459-112108467) within the embryonic Sox9 testis enhancer was targeted using an sgRNA (equivalent to CTCAGCTGTTTGTTTAGAAGTGG) and an ssODN template with CRISPR/Cas9 technology, resulting in it being replaced with GGGGGGGGAA. This allele was created in zygotes carrying the Rr504^em2Takas allele on the paternal chromosome and embryos carrying both alleles on the same chromosome were selected. (J:334329)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr504 Mutation: 0 strains or lines available

References

• Original: J:334329 Ogawa Y, et al., SOX9 and SRY binding sites on mouse mXYSRa/Enh13 enhancer redundantly regulate Sox9 expression to varying degrees. Hum Mol Genet. 2023 Jan 1;32(1):55-64
• All: 1 reference(s)