Rr592^em1Rnis
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr592^em1Rnis
• Name: regulatory region 592; endonuclease-mediated mutation 1, Riko Nishimura
• MGI ID: MGI:7852298
• Synonyms: E308^delta
• Gene: Rr592 Location: unknown Genetic Position: Chr11, Syntenic
• Alliance: Rr592^em1Rnis page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The chondrocyte-specific Sox9 enhancer, located upstream, was targeted using sgRNAs (equivalent to TGCTAGGAGACTCGTCAATGGGG, CCTTCTCCAAGGTGGATTTCATG, CCTTTGGATTCCCTACCCACATG and CCACATGTGATAGATTAGACATA) with CRISPR/Cas9 technology, resulting in a deletion. (J:358821)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr592 Mutation: 0 strains or lines available

References

• Original: J:358821 Ichiyama-Kobayashi S, et al., Chromatin profiling identifies chondrocyte-specific Sox9 enhancers important for skeletal development. JCI Insight. 2024 Jun 10;9(11)
• All: 1 reference(s)