Rr593^em1Emta
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr593^em1Emta
• Name: regulatory region 593; endonuclease-mediated mutation 1, Emmanouil Tampakakis
• MGI ID: MGI:7852482
• Synonyms: Actn2 enh del
• Gene: Rr593 Location: unknown Genetic Position: Chr13, Syntenic
• Alliance: Rr593^em1Emta page

Mutation origin

• Strain of Origin: (C57BL/6 x SJL)F2

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The Actn2 enhancer was targeted using sgRNAs (equivalent to GCCAGGCCTGATGGACCTC and ACTGATGGGCTAGTATGATC) with CRISPR/Cas9 technology, resulting in its deletion. (J:358600)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr593 Mutation: 0 strains or lines available

References

• Original: J:358600 Htet M, et al., A transcriptional enhancer regulates cardiac maturation. Nat Cardiovasc Res. 2024 Jun;3(6):666-684
• All: 1 reference(s)