Tafa5^em1Yw
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tafa5^em1Yw
• Name: TAFA chemokine like family member 5; endonuclease-mediated mutation 1, Ying Wang
• MGI ID: MGI:8161954
• Synonyms: Fam19a5^-
• Gene: Tafa5 Location: Chr15:87428500-87643565 bp, + strand Genetic Position: Chr15, 42.1 cM
• Alliance: Tafa5^em1Yw page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Intragenic deletion, Nucleotide substitutions
• Mutation details: CRISPR/Cas9 technology generated a 32 bp deletion (CCAGCCACGGAGGACGATCGCCCGGCAGACAG) and mutated four bases (CACG) in exon 2. Quantitative real-time PCR indicated severely reduced mRNA level in the brain and immunofluorescence showed absence of expression in the brain (J:360963)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tafa5 Mutation: 9 strains or lines available

References

• Original: J:360963 Huang S, et al., FAM19A5/TAFA5, a novel neurokine, plays a crucial role in depressive-like and spatial memory-related behaviors in mice. Mol Psychiatry. 2021 Jun;26(6):2363-2379
• All: 1 reference(s)