D1Pas1^em1Dean
Endonuclease-mediated Allele Detail

Summary

• Symbol: D1Pas1^em1Dean
• Name: DNA segment, Chr 1, Pasteur Institute 1; endonuclease-mediated mutation 1, Jurrien Dean
• MGI ID: MGI:8169118
• Synonyms: D1Pas1^Null
• Gene: D1Pas1 Location: Chr1:186699613-186702824 bp, + strand Genetic Position: Chr1, 90.09 cM
• Alliance: D1Pas1^em1Dean page

Mutation origin

• Strain of Origin: (C57BL/6 x DBA/2)F2

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using crRNAs targeting regions flanking the translation initiation site, CAGAGTTCTCCGTACTCTTC and TCTGGCTGTCCCGAGACGTC, deleted a fragment that includes the start codon. (J:360837)

Expression

In Mice Carrying this Mutation:	1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any D1Pas1 Mutation: 13 strains or lines available

References

• Original: J:360837 Choi H, et al., RNA helicase D1PAS1 resolves R-loops and forms a complex for mouse pachytene piRNA biogenesis required for male fertility. Nucleic Acids Res. 2024 Oct 28;52(19):11973-11994
• All: 1 reference(s)