Alg3em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Alg3em1(IMPC)J |
| Name: |
ALG3 alpha-1,3- mannosyltransferase; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6194900 |
| Gene: |
Alg3 Location: Chr16:20424208-20429515 bp, - strand Genetic Position: Chr16, 12.48 cM
|
| Alliance: |
Alg3em1(IMPC)J page
|
| IMPC: |
Alg3 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AACTGGCCCTGGCCTGAAGT, GTTCACCCAGAGAATGCCGT, CAGGTTTGGGGAGCTGACGT and AGAGATTCTACCTCATTCCC, which resulted in a 536 bp deletion beginning at Chromosome 16 position 20,608,702 bp and ending after 20,609,237 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000314958, ENSMUSE00001226643, and ENSMUSE00001255837 (exons 2,3,4) and 127 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 65 and early truncation 5 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|
Analysis Tools
