Image |
|
||||
Caption | Generation of the Ightm1.1Vmd allele. Schematic illustration of targeting construct used to replace endogenous Sepsilon with Smu to make SmuKI mice. Solid triangles represent Cre recombination sites. The Neomycin (neo) cassette was subsequently removed by expression of Cre-recombinase. The construct for targeting the C57BL/6 IgE locus in ES cells was made using recombineering and standard molecular cloning techniques. Briefly, a 7-kb genomic fragment (assembly NCBI37/mm9, chr12:114,510,510-114,517,497) from a mouse BAC (RP23-135L12) containing the Sepsilon region was retrieved into a plasmid (pBlight-DTA, where DTA is Diptheria toxin alpha), resulting in pBlight-DTA-IgE. Second, a loxP-PGK-em7-Neo-BGHpA-loxP-HindIII-SalI-AscI-NheI cassette was inserted into the IgE fragment using homologous recombination, replacing the endogenous Sepsilon region (NCBI37/mm9, chr12: 114,512,999-114,515,053) with a floxed Neo and polylinker for subsequent insertion of Smu (pBlight-DTA-IgE-lox-Neo-lox-MCS, where MCS is multiple cloning sequence). Finally, a 4.9-kbendogenous HindIII-NheI fragment containing C57BL/6 Smu was cloned into pBlight-DTA-IgE-lox-Neo-lox-MCS using three-way ligation (ligation of a 6.2 kb XhoIHindIII fragment and a 4.1-kb XhoI-NheI fragment, both from pBlight-DTA-IgE-Neo-MCS, to the 4.9-kb HindIII-NheI Smu fragment. The resulting construct is called pBlight-DTA-IgE-lox-neo-lox-S. C57BL/6 ES cells were targeted using standard methods (G418 positive and DTA negative selection), and positive clones identified using PCR and Taqman analysis. Correctly targeted clones were confirmed by Southern blotting using HindIII digested genomic DNA and an external 3' probe. The sequence of the external 3' probe (amplified by PCR) is as follows:5'-TAATGGACGATCGGGAGATAACTGATACACTTGCACAAACTGTTCTAATCAAGGAGGAAGGCAAACTAGCCTCTACCTGCAGTAAACTCAACATCACTGAGCAGCAATGGATGTCTGAAAGCACCTCACCTGCAAGGTCACCTCCCAAGGCGTAGACTATTTGGCCCACACTCGGAGATGCCCAGGTAGGTCTACACTCGCCTGATGTCCAACCTCAGAGTCCTGAGGGAAAGGCAGGCTCTCACACAGCCCTCCTCCCCGACAGATCATGAGCCACGGGGTGTGATTACCTACCTGATCCCACCCAGCCCCCTGGACCTGTATCAAAACGGTGCTCCCAAGCTT-3'( | ||||
Copyright | This image is from Misaghi S, Proc Natl Acad Sci U S A 2013 Sep 24;110(39):15770-5. Copyright 2013 National Academy of Sciences, U.S.A. J:201147 | ||||
Associated Alleles |
|
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO) |
||
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support. |
last database update 12/10/2024 MGI 6.24 |
![]() |
|