Mapping Data

Experiment

• Experiment
  TEXT-Genetic Cross
• Chromosome
  7
• Reference
  J:80767 Watabe-Rudolph M, et al., The mouse rib-vertebrae mutation is a hypomorphic Tbx6 allele. Mech Dev. 2002 Dec;119(2):251-6
• ID
  MGI:2448611

Genes

Gene	Allele	Assay Type
Tbx6	Tbx6^rv	visible phenotype
D7Mit164		PCR
D7Mit188		PCR
D7Mit165

Notes

• Experiment
  Rib-vertebrae Tbx6^rv allele arose in C57BL/6 mice and was maintained on a mixed 129/C57 genetic background. Interspecific backcross animals were generated by mating rv/rv with (rv/rv CAST/Ei)F1 and (rv/rv MOLF/Ei)F1 animals. A total of 2487 meioses were analysed.
  The locus order was as follows (in cM standard error) D7Mit164 - (1 +/-0.2) - Tbx6^rv - (0.04 +/-0.04) - D7Mit188 - (1 +/- 0.2) - D7Mit165. An identified STS was the closest marker to rv and was identified using the following primers: rv2kb-5_for CAGAAAGGCATAGTCCTGGAAC rv2kb-5_rev TGGTAGTTTGAATAACGATGGC).. The region containing the rv allele was narrowed to approximately 250 kb.