About   Help   FAQ
GLN3 Probe Detail
Nucleotide
Probe/Clone
  • Name
    GLN3
  • Sequence Type
    oligo
  • ID
    MGI:10795
  • Region Covered
    contains the U5 region of the GLN3 retrotransposon LTR (CCGATTCGACGTGTACCCAAGAA)
  • Insert Size
    23 bp
Source
  • Species
    Not Specified
Genes
Gln3-1 GLN retrotransposon family 3-1
Gln3-2 GLN retrotransposon family 3-2
Gln3-3 GLN retrotransposon family 3-3
Gln3-4 GLN retrotransposon family 3-4
Gln3-5 GLN retrotransposon family 3-5
Gln3-6 GLN retrotransposon family 3-6
Gln3-7 GLN retrotransposon family 3-7
Gln3-8 GLN retrotransposon family 3-8
Gln3-9 GLN retrotransposon family 3-9
Polymorphisms
J:2519 Lueders KK, Mouse Genome. 1992;90(3):436-38
Endonuclease Gene Allele Fragments Strains
HindIII Gln3-1 b 20kb C57BL/6J
d absent DBA/2J
HindIII Gln3-2 b 4.7kb C57BL/6J
d absent DBA/2J
HindIII Gln3-3 b 4.6kb C57BL/6J
d absent DBA/2J
HindIII Gln3-4 b 3.4kb C57BL/6J
d absent DBA/2J
HindIII Gln3-5 b absent C57BL/6J
d 12.0kb DBA/2J
HindIII Gln3-6 b absent C57BL/6J
d 4.9kb DBA/2J
HindIII Gln3-7 b absent C57BL/6J
d 1.9kb DBA/2J
J:22095 Lueders KK, Mouse Genome. 1994;92(4):691-693
Endonuclease Gene Allele Fragments Strains
HindIII Gln3-2 a absent A/J
b ~4.5kb C57BL/6J
HindIII Gln3-4 a absent A/J
b ~3.8kb C57BL/6J
HindIII Gln3-5 a ~15.0kb A/J
b absent C57BL/6J
HindIII Gln3-6 a ~4.8kb A/J
b absent C57BL/6J
HindIII Gln3-7 a ~1.8kb A/J
b absent C57BL/6J
HindIII Gln3-9 a absent A/J
b ~4.6kb C57BL/6J
J:22798 Lueders KK, Mamm Genome. 1995 Feb;6(2):134-6
Endonuclease Gene Allele Fragments Strains
HindIII Gln3-2 b ~4.3kb C57BL/6J
d absent C57BLKS/J, DBA/2J
HindIII Gln3-3 b ~3.3kb C57BL/6J
d absent C57BLKS/J, DBA/2J
HindIII Gln3-4 b ~3.3kb C57BL/6J
d absent C57BLKS/J, DBA/2J
HindIII Gln3-5 b absent C57BL/6J
d ~10.2kb C57BLKS/J, DBA/2J
HindIII Gln3-6 b absent C57BL/6J
d ~4.5kb C57BLKS/J, DBA/2J
HindIII Gln3-7 b absent C57BL/6J
d ~1.8kb C57BLKS/J, DBA/2J
HindIII Gln3-8 b absent C57BL/6J
d ~8.1kb C57BLKS/J, DBA/2J
References
J:2519 Lueders KK, Mapping of GLN retrotransposon LTR sequences in the BXD RI series. Mouse Genome. 1992;90(3):436-38
J:22095 Lueders KK, Mapping of Gln3 retrotransposon sequences in the AXB BXA RI series. Mouse Genome. 1994;92(4):691-693
J:22798 Lueders KK, Differences in intracisternal A-particle and GLN proviral loci suggest a genetic contribution from a DBA/2-like strain in generation of the C57BL/Ks strain. Mamm Genome. 1995 Feb;6(2):134-6

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory