Intron B-pA, Intron B-pB Primer Detail MGI Mouse MGI:1100995

About Help FAQ

Intron B-pA, Intron B-pB Primer Detail

Name

Intron B-pA, Intron B-pB
Primer 1 Sequence

TAAAAGCATATTGATGTTGTTG
Primer 2 Sequence

GCACTGAATGTGTATGACTTCAG
ID

MGI:1100995
Region Covered

exon B

Grid2

glutamate receptor, ionotropic, delta 2

J:42431 Zuo J, et al., Nature. 1997 Aug 21;388(6644):769-73

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	Grid2	a	larger	B6CBCa A^w-J-Grid2^Lc, BALB/cByJ-Grid2^Lc-J/+, CAST/Ei-Grid2^Lc-J, CAST/Ei-Grid2^Lc
Not Specified	Grid2	b	smaller	B6CBACa-A^w-J/A, BALB/cByJ, C3HeB/FeJ, C57BL/6J, CAST/EiJ, DBA/2J

J:42431 Zuo J, et al., Neurodegeneration in Lurcher mice caused by mutation in delta2 glutamate receptor gene [see comments]. Nature. 1997 Aug 21;388(6644):769-73

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/05/2024 MGI 6.24