49.MMIL1BG Primer Detail MGI Mouse MGI:124

49.MMIL1BG Primer Detail

Name

49.MMIL1BG
Primer 1 Sequence

CCAAGCTTCCTTGTGCAAGTA
Primer 2 Sequence

AAGCCCAAAGTCCATCAGTGG
ID

MGI:124
Product Size

257bp
Synonyms

49MMIL1BG, MMIL1BG, T15

D2Nds3	DNA segment, Chr 2, Nuffield Department of Surgery 3
Il1b	interleukin 1 beta

J:10652 Love JM, et al., Nucleic Acids Res. 1990 Jul 25;18(14):4123-30

Gene	Allele	Fragments	Strains
Il1b	d	larger	B6.PL-Thy1^a, B10.H2^nod, C57BL/6J, DBA/2J, NOD
	n	smaller	NON
	s	smallest	M. spretus

J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9

Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.

Gene	Allele	Fragments	Strains
Il1b	a	largest	BALB/cPas
	b	2nd largest	PWK/Pas
	c	3rd largest	129S2/SvPas, C3H/HePas, C57BL/6Pas, DBA/2Pas, DDK/Pas, STS/Pas
	d	4th largest	SEG/Pas, SPE/Pas, SPR/Smh

J:44 Moen CJ, et al., Oncogene. 1992 Mar;7(3):563-6

Endonuclease	Gene	Allele	Fragments	Strains
	Il1b	c	400nt	BALB/cHeA
	Il1b	s	250nt	STS/A

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D2Nds3	e	280bp	A/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac
	f	190bp	CAST/EiJ
	g	400bp	BALB/cJ
	h	270bp	AKR/J, LP/J, NON/ShiLt
	s	140bp	SPRET/EiJ

J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6

Endonuclease	Gene	Allele	Fragments	Strains
	Il1b	a	largest	BALB/cCrc
	Il1b	b	smallest	A/JCrc, AKR/Nimr, B10.D2-H2^d/Nimr, C3H/HeCrc, C57L/J, C58/OlaCrc, CBA/CaCrc, NOD/Crc, NZW/Ola

J:14462 Zuberi AR, et al., Mamm Genome. 1993 Sep;4(9):516-22

Endonuclease	Gene	Allele	Fragments	Strains
	D2Nds3	b	not given	B10.UW, C57BL/6
	D2Nds3	c	not given	CAST

J:16399 Everett ET, et al., Mamm Genome. 1994 Jan;5(1):55-7

Endonuclease	Gene	Allele	Fragments	Strains
	Il1b	b	not given	C57BL/6J
	Il1b	c	not given	CAST/EiJ

J:18309 Hess EJ, et al., Genomics. 1994 May 1;21(1):257-61

Endonuclease	Gene	Allele	Fragments	Strains
	D2Nds3	h	280bp	C3H/HeJ
	D2Nds3	s	138bp	M. spretus

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D2Nds3	a	400bp	BALB/cW
	b	280bp	A.CA/W, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
	c	270bp	129/SvW, AKR/W

J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30

J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9

J:44 Moen CJ, et al., Scc-1, a novel colon cancer susceptibility gene in the mouse: linkage to CD44 (Ly-24, Pgp-1) on chromosome 2. Oncogene. 1992 Mar;7(3):563-6

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6

J:14462 Zuberi AR, et al., High-resolution mapping of a minor histocompatibility antigen gene on mouse chromosome 2. Mamm Genome. 1993 Sep;4(9):516-22

J:16399 Everett ET, et al., The tight-skin (Tsk) mutation is closely linked to B2m on mouse chromosome 2. Mamm Genome. 1994 Jan;5(1):55-7

J:18309 Hess EJ, et al., Deletion map of the coloboma (Cm) locus on mouse chromosome 2. Genomics. 1994 May 1;21(1):257-61

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 07/05/2024 MGI 6.24