About   Help   FAQ
oYPEL111-2, 0YPEL111-496 Primer Detail
Primers
  • Name
    oYPEL111-2, 0YPEL111-496
  • Primer 1 Sequence
    GGGCAACAATTGGGATGT
  • Primer 2 Sequence
    GATCCCTGTATATGGCAGTCTCTAT
  • ID
    MGI:1277542
  • Region Covered
    5' end and flanking sequence
Genes
D14Sh1 DNA segment, Chr 14, Steve Hardies 1
Polymorphisms
J:31147 Zhao Y, et al., Genetics. 1996 Feb;142(2):549-55
Endonuclease Gene Allele Fragments Strains
Not Specified D14Sh1 b present C57BL/6J
s absent SPRET/EiJ
References
J:31147 Zhao Y, et al., Mus spretus LINE-1s in the Mus musculus domesticus inbred strain C57BL/6J are from two different Mus spretus LINE-1 subfamilies. Genetics. 1996 Feb;142(2):549-55
J:48983 Zhao Y, et al., Mus spretus LINE-1s in C57BL/6J map to at least two different chromosomes. Mamm Genome. 1998 Aug;9(8):679-80
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
06/12/2024
MGI 6.13 		The Jackson Laboratory