D14Sfk6-pA, D14Sfk6-pB Primer Detail MGI Mouse MGI:1303141

About Help FAQ

D14Sfk6-pA, D14Sfk6-pB Primer Detail

Name

D14Sfk6-pA, D14Sfk6-pB
Primer 1 Sequence

CTTGGGTAGGTCTTTCTTGC
Primer 2 Sequence

ATGTTATGTAGTAATCAGTGGC
ID

MGI:1303141

D14Sfk6

DNA segment, Chr 14, Stephen F. Kingsmore 6

J:46919 Detter JC, et al., Nucleic Acids Res. 1998 Sep 1;26(17):4091-2

Gene	Allele	Fragments	Strains
D14Sfk6	b	185bp	C57BL/6JEiJ
	c	185bp	CAST/EiJ
	p	190bp	PWK

J:46919 Detter JC, et al., Identification of novel simple sequence length polymorphisms (SSLPs) in mouse by interspersed repetitive element (IRE)-PCR. Nucleic Acids Res. 1998 Sep 1;26(17):4091-2

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13